Wykrywanie mutacji APC w kale DNA u pacjentów z guzami jelita grubego czesc 4

Po 2-minutowym cyklu denaturacji w 94 ° C, mieszaninę reakcyjną powielono przez 15 cykli w 94 ° C przez 30 sekund, 58 ° C przez 30 sekund i 70 ° C przez minutę. Sekwencje starterów były 5 GGTAATTTTGAAGCAGTCTGGGC3 w przypadku F1 5 ACGTCATGTGGATCAGCCTATTG3 w przypadku R1, 5 GGATCCTAATACGACTCACTATAGGGAGACCACCATGA-TGATGATGATGATGATGATGATGATGATGTCTGGACAAAGCAGTAAAACCG3 w przypadku F2 i 5 TTTTTTTTAACGTGATGACTTTGTTGGCATGGC3 w przypadku R2. Transkrypcja i tłumaczenie in Vitro
Transkrypcję in vitro i translację każdego z produktów PCR przeprowadzono w objętościach 5 .l na 96-studzienkowych polipropylenowych płytkach PCR. Mieszanina reakcyjna składała się z 4 .l TnT T7 Quick dla PCR DNA (Promega, Madison, Wis.), 0,25 .l 35S-Promix (Amersham Pharmacia Biotech, Piscataway, NJ), 0,25 .l dejonizowanej wody i 0,5 .l PCR produkty otrzymane przy użyciu starterów F2 i R2. Studzienki pokryto olejem mineralnym i inkubowano w 30 ° C przez 90 minut, a następnie zawartość rozcieńczono buforem do próbek Laemmli i denaturowano w 95 ° C przez 2 minuty. Białka rozdzielano na 10 do 20 procentowych żelach poliakryloamidowych z gradientem TRIS-glicyna (Invitrogen), następnie utrwalano w etanolu i suszono przed autoradiografią.
Badania sekwencji
Produkty PCR ze studzienek otrzymujące skrócone peptydy w teście skracania białka cyfrowego wyizolowano i sklonowano przy użyciu zestawu do klonowania TOPO (Invitrogen). Reakcje sekwencjonowania ze sklonowanego DNA analizowano za pomocą 96-dołkowego systemu elektroforezy kapilarnej SCE-9610 (SpectruMedix, State College, PA). W 19 przypadkach DNA przygotowano z zarchiwizowanych nowotworów, a fragmenty APC o wielkości około 200 pz amplifikowano i poddano ręcznej analizie sekwencji za pomocą ThermoSequinase (Amersham Pharmacia Biotech).
Analiza statystyczna
Wszystkie analizy statystyczne wykorzystywały dokładny test Fishera do porównania proporcji. Wszystkie podane wartości P są dwustronne.
Wyniki
Opracowanie testu skracania białek cyfrowych
Tabela 1. Tabela 1. Charakterystyka 46 pacjentów z neoplazją. Tabela 2. Tabela 2. Charakterystyka 28 pacjentów kontrolnych. Aby wykryć mutacje APC w DNA kałowym, musieliśmy przezwyciężyć dwie główne przeszkody techniczne. Pierwsze dotyczyło oczyszczenia szablonów DNA, które były wystarczająco duże, aby umożliwić nam przeprowadzenie PCR na znacznym regionie genu APC. Około 83 procent mutacji APC w sporadycznych nowotworach występuje między kodonami 1210 i 1581, obszarem 1113 nukleotydów. 41. Dla naszej analizy ważne było, aby amplifikować ten region w pojedynczym produkcie PCR, a nie w wielu zachodzących na siebie produktach PCR. Oceniane cząsteczki DNA muszą być zatem znacznie większe niż 1100 nukleotydów. Jednak kał zawiera wiele inhibitorów polimerazy DNA, a długie produkty PCR, takie jak te o 1100 bp, są szczególnie wrażliwe na takie inhibitory. W metodzie opracowaliśmy wychwycone geny APC na perełkach magnetycznych pokrytych oligonukleotydami odpowiadającymi regionowi między kodonami 1210 i 1581. Umożliwiło to amplifikację fragmentów DNA o wymaganej wielkości i stężeniu ze wszystkich analizowanych 74 próbek kału. Pacjenci z rakiem jelita grubego mieli medianę 4,3 kopii genu APC na miligram kału (tabela 1), a pacjenci bez gruczolaka jelita grubego mieli medianę 2,3 kopii genu APC na miligram kału (tabela 2).
Rysunek 1
[przypisy: czy choroby psychiczne są dziedziczne, aromatyzacja testosteronu, octan glatirameru ]
[więcej w: matołectwo, schizofrenia prosta, zatrucie talem ]