Wykrywanie mutacji APC w kale DNA u pacjentów z guzami jelita grubego cd

Po wszystkich pacjentach uzyskano ustną lub pisemną zgodę, zgodnie z mandatem udzielonym przez komisję ds. Przeglądu instytucjonalnego. Oczyszczanie DNA
DNA oczyszczono za pomocą modyfikacji procedur opisanych przez Ahlquista i wsp. 30. Wszystkie próbki kału rozmrożono w temperaturze pokojowej i homogenizowano za pomocą wytrząsarki do stolca Exactor (Exact Laboratories, Maynard, MA). Po homogenizacji, 4 g ekwiwalentu stolca każdej próbki poddano dwóm odwirowaniu (5 minut przy 2536 x g i 10 minutach przy 16 500 x g) w celu usunięcia odpowiednio dużych i małych cząstek stałych. Supernatanty inkubowano z 20 .l RNazy (0,5 mg na mililitr) przez godzinę w 37 ° C, a następnie strącano 1/10 objętości 3 moli octanu sodu na litr i równą objętość izopropanolu. Surowy DNA rozpuszczono w 10 ml TRIS-EDTA (0,01 mola TRIS na litr [pH 7,4] i 0,001 mola EDTA na litr). Hybrydowe wychwytywanie genów APC przeprowadzono przez dodanie 300 .l próbki do równej objętości 6 M roztworu izotiocyjanianu guanidyny (Invitrogen, Carlsbad, CA) zawierającego 20 pmoli dwóch biotynylowanych oligonukleotydów specyficznych dla sekwencji (5 CAGATAGCCCTGGACAAACCATGCCACCAAGCAGAAG-3 i 5 TTCCAGCAGTGTCACAGCACCCTAGAACCAAATCCAG3 , Midland Certified Reagent Company, Midland, Tex.). Po 12-godzinnej inkubacji w temperaturze 25 ° C do roztworu dodano powleczone streptawidyną kulki magnetyczne i probówki inkubowano przez dodatkową godzinę w temperaturze pokojowej. Kompleksy wychwytywania perełek hybrydowych następnie przemyto czterokrotnie buforem 1x i roztworem do przemywania (1 mol chlorku sodu na litr, 0,01 mola kwasu TRIS-chlorowodorowego na litr [pH 7,2], 0,001 mola EDTA na litr, i 0,1% Tween 20), a specyficzny dla sekwencji wychwycony DNA eluowano do 40 .l niskiego TRIS-EDTA (1 mmol TRIS na litr [pH 7,4] i 0,1 mol EDTA na litr), ogrzanego do 85 ° C, dla cztery minuty. Stężenie amplifikowalnych matryc APC w wychwyconym DNA określono za pomocą rozcieńczania ograniczającego, przy użyciu starterów F1 i R1, jak zdefiniowano poniżej, dla reakcji łańcuchowej polimerazy (PCR).
Cyfrowe obcinanie białka
PCR
Każda mieszanina reakcyjna zawierała x bufor PCR (Invitrogen), 0,9 .M oligonukleotydów F1 i R1 i 0,015 U wysokiej jakości platynowej polimerazy Taq DNA (Invitrogen) na mikrolitr. Pojedynczą mieszaninę PCR przygotowano dla każdej próbki kału i mieszaninę rozdzielono do 144 studzienek (12 rzędów po 12 studzienek w dwóch standardowych 96-dołkowych płytkach PCR); każda studzienka zawierała dwa do czterech szablonów APC rozmieszczonych w rozkładzie Poissona. Po początkowym cyklu denaturacji w 94 ° C przez 2 minuty, amplifikacje przeprowadzono w następujący sposób: trzy cykle denaturacji w 94 ° C przez 30 sekund, hybrydyzacji w 67 ° C przez 30 sekund i wydłużania w 70 ° C przez minutę ; trzy cykle denaturacji w 94 ° C przez 30 sekund, hybrydyzacji w temperaturze 64 ° C przez 30 sekund i wydłużania w 70 ° C przez minutę; trzy cykle denaturacji w 94 ° C przez 30 sekund, hybrydyzacji w 61 ° C przez 30 sekund i wydłużania w 70 ° C przez minutę; i 50 cykli denaturacji w 94 ° C przez 30 sekund, hybrydyzacji w 58 ° C przez 30 sekund i wydłużania w 70 ° C przez minutę. Jeden mikrolitr mieszaniny reakcyjnej dodano do 10-.l mieszaniny reakcyjnej PCR o tym samym składzie jak wyżej opisany, z tym wyjątkiem, że użyto starterów F2 i R2
[więcej w: potencjał oksydoredukcyjny, czy choroby psychiczne są dziedziczne, homilopatia ]
[więcej w: tymoleptyki, gemfibrozyl, dieta po usunięciu wyrostka ]