Czyste czerwone komórki Aplasia i antytrytropoetyna u pacjentów leczonych rekombinowaną erytropoetyną ad 6

W opisanych tutaj przypadkach najbardziej prawdopodobnym wyjaśnieniem jest fakt, że przeciwciała antytrytropetynowe zostały indukowane przez terapię epoetyną. Pogląd ten potwierdzają wyniki badań próbek surowicy od 4 z 13 pacjentów, które uzyskano od do 15 miesięcy przed wystąpieniem aplazji czysto krwinkowej. Próbki te nie zawierały wykrywalnej aktywności antierythropoietin. Jesteśmy świadomi tylko trzech poprzednich doniesień na temat przeciwciał przeciw antytryropoetynom u pacjentów otrzymujących epoetynę.7-9 Identyfikacja w ciągu trzech lat 13 pacjentów, u których przeciwciała neutralizujące przeciwko erytropoetynom i czysta aplazja komórek czerwonych powstałe podczas leczenia epoetyną silnie sugerują, że rekombinowany hormon odgrywa rolę w wywoływaniu zaburzenia. Nie dysponujemy jednak informacjami na temat tego, w jaki sposób hormon może wywoływać powstawanie przeciwciał antytryptoetyny. Read more „Czyste czerwone komórki Aplasia i antytrytropoetyna u pacjentów leczonych rekombinowaną erytropoetyną ad 6”

Promowanie leków na receptę dla konsumentów ad 7

Dane, które wykorzystaliśmy, zostały zebrane przez niezależne firmy konsultingowe i nie opierają się na raportach producentów farmaceutyków. Jak już zauważyliśmy, kilka elementów budżetu na promocję nie było dostępnych dla naszych analiz, w tym wydatków na spotkania i wydarzenia oraz wydatków na reklamy internetowe. Poza promocją jawną mogą być podejmowane inne rodzaje wysiłków przez firmy farmaceutyczne, takie jak tak zwane badania, które mają istotny element promocyjny, którego wielkości nie jesteśmy w stanie oszacować. Pomimo tego ograniczenia jest mało prawdopodobne, aby nasze jakościowe wnioski, które dotyczą tempa zmian wydatków na reklamy bezpośrednie dla konsumentów i ich znaczenie w odniesieniu do promocji dla pracowników służby zdrowia, zostałyby zmienione dzięki dostępności bardziej kompleksowych danych. Większość działań promocyjnych w branży farmaceutycznej nadal koncentruje się na lekarzu. Read more „Promowanie leków na receptę dla konsumentów ad 7”

Akty terroryzmu

Ludzie na całym świecie byli zszokowani katastrofą z 11 września 2001 roku. Chcę podkreślić, co redaktorzy pisali o ubezpieczeniu medycznym w artykule redakcyjnym czasopisma na ten temat (wydanie z 11 października) 1: Ofiary i ich rodziny muszą otrzymać pomoc medyczną. i dbałości o zdrowie psychiczne, niezależnie od ich zdolności płatniczej i tego, czy mają ubezpieczenie medyczne.
Uważam, że międzynarodowa społeczność lekarzy powinna walczyć o sprawiedliwość w leczeniu. Warto zauważyć, że 40 milionów Amerykanów nie ma ubezpieczenia medycznego, a miliardy ludzi w Trzecim Świecie nie otrzymują podstawowej opieki medycznej. Read more „Akty terroryzmu”

Powstanie na Tajwanie odporności na fluorochinolony w Salmonella enterica Serotype Choleraesuis cd

Metoda ta była zgodna z poprzednio opisanymi procedurami 22, z tym wyjątkiem, że w końcowej amplifikacji użyto 15 .l szablonów DNA z dołączonym do adaptera DNA. Każdy izolat analizowano co najmniej dwa razy, aby zapewnić powtarzalność wyniku. Kryteria zaproponowane przez Tenover i wsp.23 zostały wykorzystane do analizy odcisków palców DNA generowanych przez IRS-PCR. Fragment DNA 313 pz powielono za pomocą starterów PI (5 TACCGTCATAGTTATCCACGA) i P2 (5 TTTTTACGCCATGAACGT), 12,13, które odpowiadają nukleotydom 434 do 454 i 142 do 161 genu dla gyrazy DNA A (gyrA), odpowiednio. Amplifikowany fragment zawiera region gRA.12, determinujący oporność na chinolony, produkty PCR uzyskane po amplifikacji oczyszczono przy użyciu zestawu Wizard PCR Preps (Promega) i sekwencjonowano za pomocą automatycznego sekwencera (ABI 373A, Perkin-Elmer, Applied Biosystems ). Read more „Powstanie na Tajwanie odporności na fluorochinolony w Salmonella enterica Serotype Choleraesuis cd”

Ekspresja p53 i rokowanie u dzieci z złośliwymi glejakami czesc 4

Pierwszorzędowym punktem końcowym był czas przeżycia bez progresji, zdefiniowany jako czas od wejścia do badania do progresji choroby. Porównania wyników oparto na teście log-rank; szacunki przeżycia, z błędami standardowymi, zostały obliczone na podstawie oszacowania limitu dla produktu.41 Ponieważ uznano, że ekspresja p53 i status TP53 mogą korelować z diagnozą histopatologiczną, przeprowadzono analizę związku między tymi ustaleniami a wynikiem. z warstwowym testem logarytmicznym 41, który dostosował się do różnych potencjalnych czynników prognostycznych. Porównania rozkładu ekspresji p53 i statusu mutacji między różnymi podgrupami pacjentów oparto na dwustronnym teście dokładnym Fishera i teście .2, odpowiednio .42 Wyniki
Charakterystyka pacjentów
Próbki od 148 z 231 pacjentów były dostępne do analizy; 115 można było ocenić pod kątem ekspresji p53, a 121 zawierało wystarczającą tkankę do analizy mutacji TP53. Dwadzieścia cztery próbki, które nie wykazywały immunoreaktywności dla antygenów kontroli wewnętrznej (np. Read more „Ekspresja p53 i rokowanie u dzieci z złośliwymi glejakami czesc 4”

Zmniejszenie częstości występowania cukrzycy typu 2 poprzez interwencję Lifestyle lub Metformin czesc 4

Do tego czasu uzyskaliśmy dowody skuteczności na podstawie 65 procent planowanych osób-lat obserwacji. Aby utrzymać poziom błędu typu I równy 0,05 dla istotności w parach porównań ryzyka cukrzycy między grupami, z korektą dla powtarzających się analiz pośrednich, test sekwencyjno-sekwencyjny 18 dla grupy wymagał wartości P mniejszej niż 0,0159. W przypadku porównań par innych wyników zastosowano kryterium skorygowane za pomocą Bonferroniego o wartości P <0,0167. Projekt badania dostarczył 90-procentowej mocy, aby wykryć 33-procentową redukcję z częstości występowania 6,5 przypadków cukrzycy na 100 osobolat, z 10-procentową utratą obserwacji w ciągu roku. Czas do uzyskania wyniku oceniano za pomocą metod opartych na tabeli trwałości.19 Zmodyfikowane krzywe limitu dla produktu dla łącznej częstości występowania cukrzycy porównywano z zastosowaniem testu log-rank. Read more „Zmniejszenie częstości występowania cukrzycy typu 2 poprzez interwencję Lifestyle lub Metformin czesc 4”

Hamowanie spironolaktonem i ACE w przewlekłej niewydolności nerek

Jestem zaskoczony, że autorzy listu zatytułowanego Spironolakton jako dodatek do hamowania ACE w zmniejszaniu białkomoczu u pacjentów z przewlekłą chorobą nerek (wydanie z 20 września) stwierdzili, że zmniejszenie białkomoczu obserwowano po podaniu 25 mg spironolaktonu na nie można wyjaśnić wpływem ciśnienia krwi, ponieważ nie było znaczącej różnicy w ciśnieniu krwi przed i po podaniu spironolaktonu.
U każdego z ośmiu pacjentów średnie ciśnienie krwi (obliczone jako ciśnienie skurczowe + [0,67 × ciśnienie rozkurczowe]) było niższe po leczeniu niż przed leczeniem, a średnia zmiana (. SE) wynosiła 10 . 1,76 mm Hg. Jest dobrze ustalone, że obniżenie średniego ciśnienia krwi może powodować zmniejszenie białkomoczu. Read more „Hamowanie spironolaktonem i ACE w przewlekłej niewydolności nerek”

Porównanie doustnych i miejscowych kortykosteroidów u pacjentów z pemfigoidem pęcherzowym

Pemfigoid pęcherzowy jest najczęstszą autoimmunologiczną chorobą skóry osób starszych. Ponieważ osoby starsze mają niską tolerancję na standardowe schematy doustnych kortykosteroidów, badaliśmy, czy silnie działające miejscowe kortykosteroidy mogą zmniejszać śmiertelność podczas kontrolowania choroby.
Metody
Łącznie 341 pacjentów z pemfigoidem pęcherzowym włączono do randomizowanego, wieloośrodkowego badania i stratyfikowano zgodnie z ciężkością ich choroby (umiarkowaną lub rozległą). Pacjenci byli losowo przydzielani do otrzymywania miejscowego kremu propionianu klobetazolu (40 g na dzień) lub doustnego prednizonu (0,5 mg na kilogram masy ciała na dzień dla osób z umiarkowaną chorobą i mg na kilogram dziennie dla osób z rozległymi chorobami). Pierwszorzędowym punktem końcowym było całkowite przeżycie. Read more „Porównanie doustnych i miejscowych kortykosteroidów u pacjentów z pemfigoidem pęcherzowym”

Wykrywanie mutacji APC w kale DNA u pacjentów z guzami jelita grubego

Nieinwazyjne metody wykrywania guzów jelita grubego mogą potencjalnie zmniejszyć chorobowość i umieralność z powodu tej choroby. Mutacje w genie gruczolakowatej polipowatości coli (APC), które inicjują nowotwory jelita grubego, teoretycznie zapewniają optymalny marker do wykrywania guzów jelita grubego. Celem naszych badań było określenie możliwości wykrywania mutacji APC w DNA kałowym za pomocą nowo opracowanych metod.
Metody
Oczyściliśmy DNA z rutynowo pobieranych próbek kału i przeszukiwaliśmy pod kątem mutacji APC przy użyciu nowego podejścia zwanego cyfrowym skróceniem białka. Wiele różnych mutacji można potencjalnie zidentyfikować w delikatny i specyficzny sposób za pomocą tej techniki. Read more „Wykrywanie mutacji APC w kale DNA u pacjentów z guzami jelita grubego”

Wykrywanie mutacji APC w kale DNA u pacjentów z guzami jelita grubego ad 8

Wśród opublikowanych badań mutacji kałalko-DNA, 19-33 z niewielu używało więcej niż trzech próbek stolca od zdrowych osób jako kontroli. W jednym z takich badań mutacje c-Ki-ras zidentyfikowano w 7% kontroli.30 Niesdysplastyczne nieprawidłowe ogniska krypt i małe hiperplastyczne polipy, które występują stosunkowo często u normalnych ludzi, ale nie są uważane za prekursory raka, często zawierają c Mutacje -Ki-ras, ale nie mutacje APC, 38-40 odkrycie dodatkowo podkreślające wartość APC dla testów opartych na kale. Podsumowując, możliwe jest wykrycie mutacji APC w kałowym DNA u pacjentów z potencjalnie wyleczalnymi guzami jelita grubego. Należy jednak podkreślić, że nasze badanie nie wykazuje, że test skracania białka cyfrowego jest klinicznie użytecznym testem przesiewowym. Interesujące było to, że pięciu pacjentów z grupy kontrolnej w naszym badaniu przeszło kolonoskopię z powodu dodatniego testu krwi utajonej w kale, podczas gdy w kolejnych sześciu przyczyną kolonoskopii było krwawienie z odbytu, co uniemożliwia badanie krwi utajonej w kale. Read more „Wykrywanie mutacji APC w kale DNA u pacjentów z guzami jelita grubego ad 8”