Powstanie na Tajwanie odporności na fluorochinolony w Salmonella enterica Serotype Choleraesuis cd

Metoda ta była zgodna z poprzednio opisanymi procedurami 22, z tym wyjątkiem, że w końcowej amplifikacji użyto 15 .l szablonów DNA z dołączonym do adaptera DNA. Każdy izolat analizowano co najmniej dwa razy, aby zapewnić powtarzalność wyniku. Kryteria zaproponowane przez Tenover i wsp.23 zostały wykorzystane do analizy odcisków palców DNA generowanych przez IRS-PCR. Fragment DNA 313 pz powielono za pomocą starterów PI (5 TACCGTCATAGTTATCCACGA) i P2 (5 TTTTTACGCCATGAACGT), 12,13, które odpowiadają nukleotydom 434 do 454 i 142 do 161 genu dla gyrazy DNA A (gyrA), odpowiednio. Amplifikowany fragment zawiera region gRA.12, determinujący oporność na chinolony, produkty PCR uzyskane po amplifikacji oczyszczono przy użyciu zestawu Wizard PCR Preps (Promega) i sekwencjonowano za pomocą automatycznego sekwencera (ABI 373A, Perkin-Elmer, Applied Biosystems ). Uzyskane sekwencje analizowano za pomocą oprogramowania PCGene (IntelliGenetics). Poszukiwanie sekwencji homologicznych przeprowadzono w bazie danych GenBank przy użyciu oprogramowania FASTA.
Aby zbadać, czy oporność jest mediowana przez plazmid, plazmidy opornych izolatów poddano elektroforezie na żelu agarozowym, a następnie przeniesiono na membrany Zeta-Probe (Bio-Rad). Aby przygotować sondę, oczyszczony produkt PCR znakowano [.-32P] 2 -deoksycytydyno-5 -trifosforanem z zastosowaniem systemu do znakowania DNA z losowymi starterami (GIBCO-BRL). Hybrydyzację DNA-DNA przeprowadzono jak opisano wcześniej.18
Analiza statystyczna
Test chi-kwadrat wykorzystano do określenia istotności różnic. Różnicę uznano za statystycznie istotną, jeśli wartość P była mniejsza niż 0,05. Wszystkie analizy statystyczne zostały wykonane przy użyciu oprogramowania Epi Info (wersja 6.04).
Wyniki
Nadzór S. enterica Serotyp Choleraesuis
Ryc. 1. Ryc. 1. Pojawienie się oporności na fluorochinolony u izolatów Salmonella enterica Serotyp Choleraesuis na Tajwanie. Panel A pokazuje całkowitą roczną liczbę izolatów salmonelli z Chang Gung Memorial Hospital i Chang Gung Children Hospital od 1987 do 2000 (słupki) i procent tych izolatów, którym był S. enterica serotyp choleraesuis (krzywa). Panel B pokazuje całkowitą liczbę kwartałów izolatów S. enterica serotyp choleraesuis z tych szpitali od czwartego kwartału 1996 r. Do trzeciego kwartału 2001 r. (Słupki) i procent tych izolatów, które były oporne na cyprofloksacynę (krzywa). Cyprofloksacyna nie była dostępna w tych szpitalach przed październikiem 1996 r.
Przeanalizowano łącznie 8196 izolatów salmonelli. Roczna liczba izolatów wzrosła z 232 w 1987 r. Do 700 w 2000 r. (Średnia, 585, maksymalna, 910 w 1995 r.). W stosunku do wszystkich izolatów bakterii badanych w tym laboratorium (26 731 w 1987 r. I 49,778 w 2000 r.) Odsetek izolatów salmonelli znacznie wzrósł (P <0,001), z 0,9% w 1987 r. Do 1,4% w 2000 r. (Średnia, 1,5%; maksymalnie 2,1 procent w 1995 r.). Łącznie 501 oddzielnych klinicznych izolatów S. enterica serotyp choleraesuis zostało odzyskanych w naszym laboratorium w latach 1987-2000. W sumie 359 (72 procent) zostało wyizolowanych z krwi [więcej w: czy choroby psychiczne są dziedziczne, homilopatia, pasemka caspariego` ] [podobne: jaka dieta na redukcje, octan glatirameru, afekt patologiczny ]