Powstanie na Tajwanie odporności na fluorochinolony w Salmonella enterica Serotype Choleraesuis

Tło Salmonella enterica serotyp choleraesuis jest przyczyną poważnych infekcji ogólnoustrojowych. Ponieważ fluorochinolony są lekiem z wyboru w leczeniu ciężkich zakażeń salmonellą, pojawienie się i rozsiewanie opornego na fluorochinolon S. enterica serotyp choleraesuis ma kliniczne konsekwencje.
Metody
Na Tajwanie od 1987 r. Istnieje system nadzoru oparty na szpitalach w celu monitorowania częstości zakażeń S. Read more „Powstanie na Tajwanie odporności na fluorochinolony w Salmonella enterica Serotype Choleraesuis”

Aspergilloma jako powikłanie stymulacji serca

Trzy lata po ablacji radiowej węzłów przedsionkowo-komorowych, a następnie wszczepieniu stymulatora dwukomorowego, 59-letni mężczyzna miał stopniowy wzrost gorączki i dyskomfortu lewej piersi. Nie miał historii odpornościowej ani choroby płuc. Trzy zestawy kultur krwi były sterylne. Rentgen klatki piersiowej wykazał minimalne powiększenie cienia serca i oczyszczenie pól płucnych. Echokardiografia przezprzełykowa wykazała masę przywiązaną do zastawki trójdzielnej, z łagodną niedomykalnością trójdzielną (Panel A, LA oznacza lewe przedsionki, lewą komorę lewej komory, prawą komorę prawej komory i prawe przedsionek RZS). Read more „Aspergilloma jako powikłanie stymulacji serca”

Zarządzanie śmiercią w oddziale intensywnej terapii: przejście od leczenia do komfortu ad

Rzeczywiście, jest oczywiste, że autorzy mają duże doświadczenie w nauczaniu tych umiejętności. W przypadku pedagoga-klinicysty rozdziały w tej sekcji mogłyby z łatwością stać osobno jako punkty startowe dla sesji dydaktycznych dotyczących opieki krytycznej. Redaktorom udało się osiągnąć cel, ale książka ma kilka słabości. Ze względu na szeroki zakres tematów wiele tematów nie jest szczegółowo omówionych, a czytelnicy mogą chcieć zwrócić się do innych źródeł wymienionych w książce. Niektóre rozdziały zawierają zbędne informacje, problem, który jest najbardziej widoczny, gdy książka jest czytana od deski do deski, ale byłaby mniej problematyczna, gdyby była używana jako odnośnik tematyczny. Read more „Zarządzanie śmiercią w oddziale intensywnej terapii: przejście od leczenia do komfortu ad”

Zarządzanie śmiercią w oddziale intensywnej terapii: przejście od leczenia do komfortu

Dla tych, którzy opiekują się pacjentami na oddziale intensywnej terapii (OIOM), codzienne wydarzenie to zajmowanie się złożonymi problemami medycznymi i psychospołecznymi dotyczącymi śmierci i umierającego pacjenta. Jednak niezbędne umiejętności praktyczne rzadko uczą się w ramach formalnego szkolenia, a wielu z nas podejść do tych problemów niezręcznie i z pewnym dyskomfortem. Redaktorzy Zarządzania Śmiercią w Oddziale Intensywnej Terapii postawili przed sobą ogromny cel: stworzyć książkę, która w sposób naukowy recenzuje temat śmierci i umierania na OIOM-ie i dostarcza konkretnych, praktycznych porad dotyczących opieki nad chorymi i umierającymi w stanie krytycznym. Jak stwierdzono we wstępie, ogólnym celem tej książki jest poprawa opieki nad pacjentami umierającymi na OIOM-ie. Cel, który zostanie osiągnięty, po części, redaktorzy mówią: gdy książka zostanie znaleziona, ubrana i nabazgrana na posterunkach pielęgniarek i pracowniach lekarzy. Read more „Zarządzanie śmiercią w oddziale intensywnej terapii: przejście od leczenia do komfortu”

Ekspresja p53 i rokowanie u dzieci z złośliwymi glejakami

Rokowanie u dzieci z glejakami o wysokim stopniu złośliwości jest niepewne, nawet jeśli uwzględni się kliniczne i histologiczne wyniki. Zbadaliśmy, czy mutacje w genie TP53 lub stopień ekspresji białka p53 w glejakach o wysokim stopniu złośliwości jest związany z przeżyciem bez progresji u dzieci z tymi nowotworami.
Metody
Zatopione w parafinie próbki złośliwych glejaków dzieci leczonych w badaniu CCG-945 Grupy Dzieci Raka oceniano na podstawie analizy mutacyjnej TP53 (121 próbek) i analizy immunohistochemicznej p53 (115 próbek). W przypadku badań mutacyjnych obszary tkanek zawierające złośliwego glejaka wyizolowano za pomocą mikrodysekcji, a DNA poddano amplifikacji opartej na reakcji łańcuchowej polimerazy i sekwencjonowaniu eksonów TP53 5, 6, 7 i 8. Przeprowadzono analizę immunohistochemiczną za pomocą zastosowanie odzyskiwania antygenu wzmocnionego przez mikrofale i przeciwciała, które wiąże zarówno p53 typu dzikiego, jak i zmutowane. Read more „Ekspresja p53 i rokowanie u dzieci z złośliwymi glejakami”

Powstanie na Tajwanie odporności na fluorochinolony w Salmonella enterica Serotype Choleraesuis ad 6

Wszystkie badane przez nas izolaty od ludzi i świń miały podobny wzór IRS-PCR i plazmidów, co sugeruje, że infekcje ludzkiego S. enterica serotyp choleraesuis zostały nabyte od świń. Wydaje się, że istnieje endemiczny szczep S. enterica serotyp choleraesuis krążący u ludzi i świń. Wyniki sekwencjonowania potwierdzają tę hipotezę, ponieważ wszystkie oporne izolaty, niezależnie od źródła, miały takie same zmiany aminokwasowe w gyrA. Read more „Powstanie na Tajwanie odporności na fluorochinolony w Salmonella enterica Serotype Choleraesuis ad 6”

Powstanie na Tajwanie odporności na fluorochinolony w Salmonella enterica Serotype Choleraesuis ad 5

Izolaty odzyskane z różnych gatunków (ludzi i trzody chlewnej) oraz w różnych latach (1997 i 2000-2001) nie różniły się istotnie rozkładem wzorców IRS-PCR (tabela 1). Nie było również znaczącej różnicy w rozkładzie wzorów pomiędzy wrażliwymi na ciprofloksacynę i opornymi na cyprofloksacynę izolatami (Tabela 1). Spośród 48 izolatów uzyskanych od ludzi w 2000 i 2001 r., 22 (46 procent) zawierało plazmid o wielkości 50 kb plus inny plazmid o wielkości 75, 90 lub 125 kb; 13 (27 procent) miało jedynie plazmid o wielkości 50 kb; a 13 (27 procent) miało tylko jeden z większych plazmidów o wielkości 75, 90 lub 125 kb. Spośród 26 izolatów ze świń 16 (62 procent) zawierało plazmid o wielkości 50 kb plus inny plazmid o wielkości 75, 90 lub 125 kb; 4 (15 procent) miało tylko plazmid o wielkości 50 kb; a 6 (23 procent) miało tylko jeden z większych plazmidów. Wzory plazmidów izolatów S. Read more „Powstanie na Tajwanie odporności na fluorochinolony w Salmonella enterica Serotype Choleraesuis ad 5”

Powstanie na Tajwanie odporności na fluorochinolony w Salmonella enterica Serotype Choleraesuis czesc 4

Inne źródła izolatów obejmowały mocz, ranę, kość, tkankę z tętniaka grzybiczego i rzadko, stolec. Jak pokazano na ryc. 1, roczna liczba izolatów wzrastała stopniowo do 1995 r., A następnie znacznie spadła w latach 1996-1998, a następnie wzrosła. Odsetek izolatów S. enterica serotyp choleraesuis wśród wszystkich izolatów salmonelli również spadł ze średnio 8,4 procent przed 1995 r. Read more „Powstanie na Tajwanie odporności na fluorochinolony w Salmonella enterica Serotype Choleraesuis czesc 4”

Powstanie na Tajwanie odporności na fluorochinolony w Salmonella enterica Serotype Choleraesuis cd

Metoda ta była zgodna z poprzednio opisanymi procedurami 22, z tym wyjątkiem, że w końcowej amplifikacji użyto 15 .l szablonów DNA z dołączonym do adaptera DNA. Każdy izolat analizowano co najmniej dwa razy, aby zapewnić powtarzalność wyniku. Kryteria zaproponowane przez Tenover i wsp.23 zostały wykorzystane do analizy odcisków palców DNA generowanych przez IRS-PCR. Fragment DNA 313 pz powielono za pomocą starterów PI (5 TACCGTCATAGTTATCCACGA) i P2 (5 TTTTTACGCCATGAACGT), 12,13, które odpowiadają nukleotydom 434 do 454 i 142 do 161 genu dla gyrazy DNA A (gyrA), odpowiednio. Amplifikowany fragment zawiera region gRA.12, determinujący oporność na chinolony, produkty PCR uzyskane po amplifikacji oczyszczono przy użyciu zestawu Wizard PCR Preps (Promega) i sekwencjonowano za pomocą automatycznego sekwencera (ABI 373A, Perkin-Elmer, Applied Biosystems ). Read more „Powstanie na Tajwanie odporności na fluorochinolony w Salmonella enterica Serotype Choleraesuis cd”

Ekspresja p53 i rokowanie u dzieci z złośliwymi glejakami ad 6

Wskaźnik przeżycia wolnego od progresji po pięciu latach wynosił 32 . 7 procent w grupie 44 pacjentów, których nowotwory nie wykazywały nadekspresji p53 i 14 . 6 procent w 37 przypadkach, w których guzy wykazywały nadmierną ekspresję p53 (P = 0,01). To powiązanie utrzymano w analizie stratyfikowanej zgodnie z histologicznymi cechami guza (p = 0,03). 13 pacjentów, u których guzy wykazywały zarówno nadekspresję p53, jak i mutacje w TP53, miało przeżycie wolne od progresji po pięciu latach wynoszące 8 . Read more „Ekspresja p53 i rokowanie u dzieci z złośliwymi glejakami ad 6”