rossmann pończochy

Testy stymulacji ACTH i poziomy siarczanu dehydroepiandrosteronu w osoczu u kobiet z nadmiernym owłosieniem cd

W przypadku pomiarów uzyskanych po 0, 30 i 60 minutach zastosowano analizę wariancji dla powtarzanych pomiarów; różnice między grupami zostały zbadane pod względem istotności statystycznej za pomocą testu Scheffé. Różnice między środkami grup oceniano za pomocą analizy wariancji i testu Scheffé. Różnice pomiędzy pacjentami w grupie 4 a normalnymi kobietami określono za pomocą niezależnych dwustronnych testów t. Wszystkie analizy statystyczne przeprowadzono za pomocą oprogramowania statystycznego ABstat (Anderson-Bell, Canon City, Colo.). Wyniki
Ryc. 1. Ryc. 1. Średnie (. ...

Więcej »

Promowanie leków na receptę dla konsumentów

Wydatki na farmaceutyki znacznie przyspieszyły w ostatnich latach i obecnie są najszybciej rosnącym składnikiem budżetu na opiekę zdrowotną1. Część wzrostu wydatków na farmację jest niemal na pewno rezultatem zwiększenia liczby wysoce skutecznych leków. Istnieje jednak powszechna obawa, że zwiększone wydatki zbyt często wynikają z większej liczby reklam leków, które nie zapewniają skuteczniejszej lub wydajniejszej opieki.2 Bezpośrednia reklama leków na receptę stała się kontrowersyjna. Zwolennicy twierdzą, że taka komunikacja ze strony przemysłu farmaceutycznego prowadzi do lepiej poin...

Więcej »

Wpływ czynnika stymulującego kolonizację granulocytów po intensywnym leczeniu indukcyjnym w nawrotowej lub opornej na leczenie ostrej białaczce czesc 4

Mediana dnia, w którym liczba neutrofilów przekroczyła 1000 na milimetr sześcienny, wynosiła 22 dzień w grupie leczonej CSF granulocytów i 34 dzień w grupie kontrolnej. Ponieważ większość pacjentów otrzymała kolejny cykl chemioterapii mielosupresyjnej po 40-dniowym okresie badania, skumulowany odsetek pozostał taki sam nawet po 40 dniach. Odzyskiwanie liczby leukocytów do ponad 1000 na milimetr sześcienny było również znacznie szybsze w grupie leczonej CSF granulocytów (P = 0,0004 w uogólnionym teście Wilcoxona). Nie obserwowano znaczącego wzrostu liczby eozynofili, monocytów lub limfocytów...

Więcej »

Przestrzeganie zasad leczenia

Metoda ta była zgodna z poprzednio opisanymi procedurami 22, z tym wyjątkiem, że w końcowej amplifikacji użyto 15 .l szablonów DNA z dołączonym do adaptera DNA. Każdy izolat analizowano co najmniej dwa razy, aby zapewnić powtarzalność wyniku. Kryteria zaproponowane przez Tenover i wsp.23 zostały wykorzystane do analizy odcisków palców DNA generowanych przez IRS-PCR. Fragment DNA 313 pz powielono za pomocą starterów PI (5 TACCGTCATAGTTATCCACGA) i P2 (5 TTTTTACGCCATGAACGT), 12,13, które odpowiadają nukleotydom 434 do 454 i 142 do 161 genu dla gyrazy DNA A (gyrA), odpowiednio. Amplifikowany fragment...

Więcej »
http://www.my-medyczni.org.pl 751#uwarunkowanie genetyczne , #ciasteczka owsiane bez mąki i cukru , #zmiany skórne u dzieci zdjęcia , #chleb orkiszowy składniki , #serial przyjaciele po angielsku , #dieta spalająca tłuszcz z brzucha , #rozciąganie odcinka lędźwiowego , #seksoholik leczenie , #zapalenie krtani u niemowląt , #rossmann zdjęcia od ręki ,