Ekspresja p53 i rokowanie u dzieci z złośliwymi glejakami ad

Łącznie 172 pacjentów w wieku od 18 miesięcy do 21 lat w chwili rozpoznania i glejaków złośliwych wewnątrzczaszkowych zostało losowo przydzielonych do leczenia adiuwantowego prednizonem, lomustyną i winkrystyną lub ośmioma lekami w jednym dniu . reim.303 Ten reżim zawierał siedem czynników o pewnej aktywności przeciwko nowotworom mózgu u dzieci: lomustyna, winkrystyna, hydroksymocznik, prokarbazyna, cisplatyna, arabinozyd cytozyny i dakarbazyna; Dodano metyloprednizolon w celu zmniejszenia obrzęku mózgu. Celem tego podejścia było ominięcie oporności na poszczególne czynniki poprzez wystawienie nowotworu na działanie wielu czynników, chociaż przy niskiej intensywności dawki. Pięćdziesięciu dziewięciu dzieci w wieku poniżej 18 miesięcy lub ze złośliwymi glejakami rdzenia kręgowego nie zostało losowo przydzielonych do schematu ośmiu leków. W badaniu wzięli udział pacjenci z 60 instytucji w okresie od kwietnia 1985 r. Do maja 1990 r. Protokół ten wymagał, aby każda instytucja przedstawiała histopatologiczne potwierdzenie obecności gwiaździaka o wysokim stopniu złośliwości (tj. Glejaka wielopostaciowego, gwiaździaka anaplastycznego lub innego kwalifikującego się glejaka stopnia III, taki jak anaplastyczny mieszany glejak). Wyniki były jednymi z najlepszych odnotowanych dla pacjentów z tymi nowotworami, z całkowitą częstością (. SE) przeżycia po pięciu latach wynoszącą 36 . 6 procent, bez znaczącej różnicy między dwiema grupami terapeutycznymi. [30]
W niniejszym badaniu, zbieranie tkanek zostało zainicjowane przez Pediatryczny Oddział Spółdzielczej Sieci Tkanek Ludzkich w kontekście badania biologii CCG, CCG-B975, które zostało zatwierdzone przez instytucjonalną komisję recenzyjną Children s Hospital of Pittsburgh. Próbki zostały zakodowane przez Spółdzielczą Sieć Tkanek Ludzkich w celu zamaskowania danych klinicznych, histologicznych i wyników od badaczy. Materiał dostarczony do analizy został ponownie zbadany przez dwóch neuropatologów, aby potwierdzić, że odpowiednie ilości tkanki były dostępne dla planowanych badań.
Analiza mutacji w TP53
We wszystkich analizach użyto próbek nowotworu zatopionych w parafinie. Zrewidowano slajdy, a bloki zawierające złośliwego glejaka podzielono na kawałki o grubości 4 .m. Skrawki wybarwiono hematoksyliną i eozyną w celu potwierdzenia, że otrzymano charakterystyczną tkankę; sąsiednie skrawki poddano barwieniu immunohistochemicznemu w celu analizy mutacji TP53 dla analizy p53 lub mikrodysekcji. Egzony 5, 6, 7 i 8 badano specyficznie, ponieważ obejmują one większość mutacji TP53 wykrytych w nowotworach astrocytowych32 i nieastriatycznych33.
Do analizy mutacyjnej próbki tkanek z regionów o najwyższym stopniu anaplazji zostały usunięte bezpośrednio z sekcji nowotworu przy użyciu technik mikrodysekcji, jak opisano. 25, 34-36 Poszczególne egzony amplifikowano w reakcji łańcuchowej polimerazy (PCR) z użyciem następujące pary starterów: ekson 5, GCAGTACTCCCCTGCCTCAA (sensowny) i GCCCCAGCTGCTCACCATCGC (antysensowny); ekson 6, GGGTCCCCAGGCCTCTGATT (sensowny) i CCTCCCAGAGACCCCAGTT (antysensowny); ekson 7, CTTGCCACAGGTCTCCCCAAG (sensowny) i GCAGGCCAGTGTGCAGGGTGG (antysensowny); i ekson 8, TTTTCCTATCCTGAGTAGTGG (sensowny) i GGTCTCCTCCACCGCTTCTTG (antysensowny), jak opisano .5,36 Produkty PCR wyizolowano i bezpośrednio sekwencjonowano przez zakończenie łańcucha dideoksy za pomocą znakowanego 35S trifosforanu deoksyadenozyny (dATP), jak opisano wcześniej25. Na podstawie autoradiogramów 6 procent żeli poliakryloamidowych odczytano sekwencje.
Wyrażanie p53
Sekcje zawierające guz pieczono w 60 ° C przez 30 minut, odparafinowano w ksylenie i ponownie uwodniono w stopniowanych stężeniach etanolu.
[przypisy: octan glatirameru, dieta na kaloryfer, homilopatia ]
[więcej w: dieta na kaloryfer, eskulap łomża, olx susz ]